Powered By Bing

Supplementary Information

Revising the Role of the Pneumococcal vex-vncRS Locus and vancomycin resistance.

Wolfgang Haas1, Jack E. Sublett1, Deepak Kaushal2 and Elaine I. Tuomanen1#.
1 Department of Infectious Diseases, St Jude Children's Research Hospital
2 Hartwell Center for Bioinformatics and Biotechnology, St Jude Children's Research Hospital
# Corresponding author

J Bacteriol. 2004 Dec;186(24):8463-71.

Supplementary Table – Primers used for cloning and PCR-ligation mutagenesis

Amplicon PCR primers
ermB

5’-AGTCCCGGGAATAAGACTTAGAAGCAAACTTAAGAGTGT

5’-CCTGCAGGGCCCGACATTTATTTGTATAGTTCATCCA

5’-TTCCAAATTTACAAAAGCGACTCA

5’-AATAAGACTTAGAAGAAACTTAAGAGTGT

5’ of vex3

5’-AGGCAAGAGCTCGATCTTCCTA

5’-AACGCCGGCTCCCTTTCTAGATTTTGTTTTAATCA

5’-GAGTCGCTTTTGTAAATTTGGAATCCCTTTCTAGATTTTGT TTTAATCA

3’ of vex3

5’-AAGCGGCCGTGCTGGATGGTGAATAAATTTGAA

5’-CATTGCGCACAGTGAGGATACA

5’-ACACTCTTAAGTTTCTTCTAAGTCTTATTTGCTGGA TGGTGAATAAATTTGAA

5’ of pep27

5’-CTAGTCGAAGGAGAGCACTTAACC

5’-TATGCCGGCGCACTAAAGTACAAAGAAAGCAACTG

3’ of pep27

5’-AAACGGCCGGCAAGAGACTATAATAGAAAATAGGG

5’-AACTTGTCCTCGGTCATCTCAC

5’ of vncR

5’-CACTCGTCAAGAGCTCCTCTAAC

5’-TTTGCCGGCTTTAACTGCTCTCTATTTTTTATTTTTC

3’ of vncR

5’-TCACGGCCGTGCGGAAAAAGCTAGACTTGGA

5’-ACTAAGCCACCTGGAACAGAGT

5’ of vncS

5’-TTGGTGGTGGTGCAGAAGTAGA

5’-GTTGCCGGCTCGCTCCAATTTATAACCAACA

5’-TGAGTCGCTTTTGTAAATTTGGAAGAAGGTATAGAT AAATATCTTTGCAA

3’ of vncS

5’-CTTCGGCCGAGATTTTCCAAAAGTCGTCCAAGA

5’-TACGAGTTGCGTTAGCGAATGC

5’-ACACTCTTAAGTTTCTTCTAAGTCTTATTAGATTTT CCAAAAGTCGTCCAAGA

5’ of lytA

5’-AGCTTGTACGCGGATCTCTTGG

5’-AATTGCCGGCTTCTACTCCTTATCAATTAAAACAACTCA

5’-TGAGTCGCTTTTGTAAATTTGGAATTCTACTCCTTATCAAT TAAAACAACTCA

3’ of lytA

5’-AGACGGCCGGATTACAGTAAAATAATAATGGAATGTC

5’-CTATCGGCGATTCACCATCAGC

5’-ACACTCTTAAGTTTCTTCTAAGTCTTATTGATTACAGTA AAATAATAATGGAATGTC

5’ of SP2155

5’-ATGCTCTTCGCTCTTCTGTTCC

5’-TCAGCCGGCCTCCCATCATTCATTATTACTGTATATTT

3’ of SP2155

5’-AACCGGCCGAATCGATCAGGACAGTCAAATC

5’-GTCAAGACGGCACAGGAAGAC

fcsK promoter

5’-AAGCGTCGACATATTGAAAAAATAAAACGTGG

5’-CGCTTCCATATGTCTCCTCCCTTCGTCCTTG

vncR gene

5’-CAAGGACGAAGGGAGGAGACATATGAAAATTTTAAT TGTAGAAGATGAAGAGATGATC

5’-GCAGGGATCCAGAACACCATATGTCGAGAAGGTATAGAT